snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA75
sequence
ATCTTCTCATTGAGCTCCTTTCTGTCCATCAGTGATAGATTATGGATTCGCACGAGAAG
AAGAGAGAATTCACAGAACTGGCACTTATCTTCTGTTTTTGCAGAAGTATATTTGGCTGT
TGTGTGAGACATTA
  Box motif
  Complementary to target RNA
length 133
organism Mus_musculus
snoRNA name SNORA75
alias U23
chromosome ⁄ contig 1
locus ⁄ host gene Ncl
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U93
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved