snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA33
sequence
TAGCCAGCCCATTAATCCGCTTACCTGAATGGTCCTGCAGACATTTAGAAAAAACTGGC
AATGGTAAGACCACATTACAAACCTTAAAGATTACTCAGGTCTTTTAAGGCCATTGAAAA
TGGCCACAATA
  Box motif
  Complementary to target RNA
length 130
organism Mus_musculus
snoRNA name SNORA33
alias ACA33
chromosome ⁄ contig 1
locus ⁄ host gene Rnf149
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4648
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved