snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA27
sequence
ACCCCCCCTTTCACTTTGCCAATTGGACTTAATGTCTTCATTGGCCATTCAAGTGGGGC
AAAGGAAATAACCTTTTAAAACTCAGGCAAACTTAAGTGTTTGTCTTGTAACCTGTCAGG
GGAAACATTA
  Box motif
  Complementary to target RNA
length 129
organism Mus_musculus
snoRNA name SNORA27
alias ACA27
chromosome ⁄ contig 5
locus ⁄ host gene Rpl21
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3371,28S:U4204
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved