snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA49
sequence
CTTCCTCAGCCTTACTCCAGGGGCTTCTTGCCTGTAGAGTGCCCTGGCATTGCCTGAGG
ATAGAGGAGAAAGCACAGCTCCCTCCCTAGCAAGACTCTGCTTTCTTGTGGGGCCTACAG
ATTGGGCTGACAGC
  Box motif
  Complementary to target RNA
length 133
organism Mus_musculus
snoRNA name SNORA49
alias ACA49
chromosome ⁄ contig 5
locus ⁄ host gene Ep400
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved