snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA66
sequence
CTGCAAACTCGATCACTAGCTCTGCATAATGTGGCAGCAGCTAAGGGAACCAGGTTTGC
TAGAGTAATTGTGGCGACAGCAATGTACCAACCTCAGAAGCTACTGAGGTGCCCATTCTG
TCACAGTACAGCC
  Box motif
  Complementary to target RNA
length 132
organism Mus_musculus
snoRNA name SNORA66
alias U66
chromosome ⁄ contig 5
locus ⁄ host gene Rpl5
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U119
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved