snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA54
sequence
CAGCACTGTTCGTAACCTGTCAGCCTTGCTGTGGCTGGTGGGTTCCATTCCAGTGCTAC
AGGATTTCCAGTGACACATGACTGACTGGCTGGCTAGTGGCTTTCAGTTTCAGGTCTTGG
AGACACAC
  Box motif
  Complementary to target RNA
length 127
organism Mus_musculus
snoRNA name SNORA54
alias ACA54
chromosome ⁄ contig 7
locus ⁄ host gene Nap1l4
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3478,28S:U4221
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved