snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA17
sequence
CATGCTCCTAGAGACATTTCAAATGTGGCTGCTGCGTCATGAGTACATCAGTAGGTGGC
AGAGAGGCAAAAACCCATGTCCACACTCAGTGTTCTGACCTATGAACATTTGAATGAGTA
GCCTAACATT
  Box motif
  Complementary to target RNA
length 129
organism Mus_musculus
snoRNA name SNORA17
alias ACA17
chromosome ⁄ contig 7
locus ⁄ host gene ENSMUSG00000078591
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4341,28S:U4280,28S:U4619
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved