snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA24
sequence
ATAAATGTAATTTTAAGGGAGACTGGCTTCCTAGCCATGGAAGAGGATGTTCTTGATTG
GCAAAGCTGTTACCATTTAGTTGATACTGGATTGGGACTTATACAAGGCGCATTC
  Box motif
  Complementary to target RNA
length 114
organism Mus_musculus
snoRNA name SNORA24
alias ACA24
chromosome ⁄ contig 7
locus ⁄ host gene 9030624J02Rik
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U864,18S:U610
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved