snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA13
sequence
AGCCTTTGTGTTGCCCATTCACTTTTGGTCACTAGTGAATGTGGTGTCAAAAAAGGCAT
AAATAAATGCTTTGCGGCCTTTCCTGTCCCTGGAGTTTGGTATCTTGGGTGTACGAGCTG
CATAAGTAACAGTA
  Box motif
  Complementary to target RNA
length 133
organism Mus_musculus
snoRNA name SNORA13
alias ACA13
chromosome ⁄ contig 7
locus ⁄ host gene Ipo7
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1248
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved