snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD15
sequence
CTTCAGTGATGACACGATGACGAGTCAGAATGGCCACGTCTTGCTCTTGGTCCCTGTCA
GTGCCATGTTCTGTGGTGCTGTACATGGTTCCCTTGGCAAAAGTGTCCTGCGCACTGATT
GATTTAGAGGCATTTGTCTGAGAAGG
  Box motif
  Complementary to target RNA
length 145
organism Mus_musculus
snoRNA name SNORD15
alias
chromosome ⁄ contig 7
locus ⁄ host gene Rps3
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A3441
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved