snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD32
sequence
GAGTCCATGATGAGCAACACTCACCATCTTTCGTTTGAGTCTCACGACTGTGAGATCAA
CCCATGCACCGCTCTGAGACTC
  Box motif
  Complementary to target RNA
length 81
organism Mus_musculus
snoRNA name SNORD32
alias
chromosome ⁄ contig 7
locus ⁄ host gene Rpl13a
organization Intronic
target RNA 18S rRNA, 28S rRNA
modification type C/D
modification site 18S:G1328, 28S:A1337
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved