snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA40
sequence
AGCACTTGTATGGGTTTTTGTTGAACTAGTGGGCAAAAACTGGAAAACAAGTGCAAGAA
CAAATCCTCTTTTGCAACCCAGAACTCATTGTTGTATGAGTTTTGGTACATGTAAGAAGG
AATATC
  Box motif
  Complementary to target RNA
length 125
organism Mus_musculus
snoRNA name SNORA40
alias ACA40
chromosome ⁄ contig 7
locus ⁄ host gene Rps16
organization Intronic
target RNA 18S rRNA, 28S rRNA
modification type H/ACA
modification site 28S:U4228,18S:U1175
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved