snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA7
sequence
GACCTCTTGGGATCGCGTCTGGAGAGTAGCTAGTATTCTTCCAGCTTCGGAAGCAAGAG
GGAGAGCAAGCCTAGCAGAGGTACCCATTCCATTCCCAGTTTGCTCGGTAGCTGGTGATT
GGAAGACACTCTGCAACATTA
  Box motif
  Complementary to target RNA
length 140
organism Mus_musculus
snoRNA name SNORA7
alias ACA7
chromosome ⁄ contig 6
locus ⁄ host gene Rpl32
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U1395,28S:U1594
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved