snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA63
sequence
GAGCAGGATCAATGTACAATGTAGCTGTAAAGTGCTACATTGTTTTACTCCCTGCTCAA
AAGAAAAGTGTTACCTTCCGAGCCCTGCCTGCTATGGTACCCAGGCAGCAGGGATGCTTG
GTTTCATACAG
  Box motif
  Complementary to target RNA
length 130
organism Mus_musculus
snoRNA name SNORA63
alias
chromosome ⁄ contig 6
locus ⁄ host gene Frmd4b
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved