snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD63
sequence
GTGCGATGATGCATTTTATTCAACACATCATTCTGAAAATAGATGTGTAGAGAAATGAT
AACTGAGCACA
  Box motif
  Complementary to target RNA
length 70
organism Mus_musculus
snoRNA name SNORD63
alias
chromosome ⁄ contig 18
locus ⁄ host gene Hspa9
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A4223
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved