snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD31
sequence
CTCACCCTGATGAACTGAATACCGCCCCAGTCTGATAGCTGTGGAGAAAGGTATTTTCT
GAGTTGTG
  Box motif
  Complementary to target RNA
length 67
organism Mus_musculus
snoRNA name SNORD31
alias
chromosome ⁄ contig 19
locus ⁄ host gene Poly:8:SNORD25
organization Poly
target RNA 28S rRNA
modification type C/D
modification site 28S:G3847
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved