snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD28
sequence
GTCAGATGATTTGAAATGATGACACTGAACACTCCGTGAAGGTGTGAATTTATAGCATG
TTAGAGTTCTGATGGCA
  Box motif
  Complementary to target RNA
length 76
organism Mus_musculus
snoRNA name SNORD28
alias
chromosome ⁄ contig 19
locus ⁄ host gene Poly:8:SNORD25
organization Poly
target RNA 18S rRNA
modification type C/D
modification site 18S:C1391
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved