snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA36
sequence
TGCTGAGTGCAGTTCCGGGCTGCTTCCATGTTCTGTTAATTAAACATTGAAATTGGCTG
AGAGAGATGATTAAATGGAAAGTGTTATTCTGTTCATATACTGATAGCTCACATAT
  Box motif
  Complementary to target RNA
length 115
organism Mus_musculus
snoRNA name SNORA36
alias ACA36
chromosome ⁄ contig 6
locus ⁄ host gene Mono:42:SNORA36
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1244,18S:U105
accession no
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved