snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA62
sequence
ATAGTGTCAGAGGGGGAGCTCTGAGAGAGTGGAGGATCGGAAGTGTGCTACATTGAATT
TATGGCAGGATTTTCGCTAACACCAGTAGAGCTTGCCTGTGACTGAAGTTTGGTAGTGGT
CACTGCCACATAC
  Box motif
  Complementary to target RNA
length 132
organism Mus_musculus
snoRNA name SNORA62
alias E2
chromosome ⁄ contig 6
locus ⁄ host gene Mono:44:SNORA62
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3509
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved