snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD116
sequence
TGATCAATGATGATTCTCAAAGATTCTCTGGAAAGCTGAACAAAATGATTGATTACTTA
ATAGCACCACTCTCTTCTGGACTGAGATTT
  Box motif
  Complementary to target RNA
length 89
organism Mus_musculus
snoRNA name SNORD116
alias
chromosome ⁄ contig 7
locus ⁄ host gene Mono:49:SNORD116
organization Mono
target RNA Unknown
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved