snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD115
sequence
GGGTCAATGGTGACAACCCAATGTCATGAAGAAAGTTGATGACATAAAATTCATGCTCA
ATAGGATTATGCTGAGGCCC
  Box motif
  Complementary to target RNA
length 79
organism Mus_musculus
snoRNA name SNORD115
alias
chromosome ⁄ contig 7
locus ⁄ host gene Poly:SNORD115
organization Poly
target RNA Unknown
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved