snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD79
sequence
TTAGTGATGATCAATAAAGTTAAACAGATGGGAATCTCTCTGAATAAGATTGAAGATTG
ATTGTTAAGCTGAAA
  Box motif
  Complementary to target RNA
length 74
organism Mus_musculus
snoRNA name SNORD79
alias
chromosome ⁄ contig 1
locus ⁄ host gene Poly:7:SNORD78
organization Poly
target RNA 28S rRNA
modification type C/D
modification site 28S:A3486
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved