snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA24
sequence
CTCCATGTATCTCTGGACTGGCCAGCTATGGACGTCTCCTTTCCAAGCCACGGAGGAGC
ACATTCTTGCTTAGTGGCAAAGCCATCACCGTGTCATTGGTATCAGATACACCGACTGGC
ACAAGGAGCATCC
  Box motif
  Complementary to target RNA
length 132
organism Mus_musculus
snoRNA name SNORA24
alias ACA24
chromosome ⁄ contig 19
locus ⁄ host gene Mono:129:SNORA24
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U864,18S:U610
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved