snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA38
sequence
TCCTCCTACAAAGGCATGTTTTTGGTTCCCTGTCCTTGGACATGTAAGAATCGAGGCAA
AGAAATTTGGTGCATTTGGAAAGGTCTGGGACCAACTCCCCACCCCCACCCCACCCCA
  Box motif
  Complementary to target RNA
length 117
organism Mus_musculus
snoRNA name SNORA38
alias
chromosome ⁄ contig 2
locus ⁄ host gene Mono:497:SNORA38
organization Mono
target RNA Unknown
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved