snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD48
sequence
AGTAATGATGATTTCTGGTGATTCTGAGTGTCTCGCTGACGCCATCACCGCAGCGCGCT
GACC
  Box motif
  Complementary to target RNA
length 63
organism Mus_musculus
snoRNA name SNORD48
alias
chromosome ⁄ contig 17
locus ⁄ host gene Poly:10:SNORD52
organization Poly
target RNA 28S rRNA
modification type C/D
modification site 28S:C2047
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved