snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD52
sequence
GAGAGTGATGATTTCACAGACTAGAGTCTCTGACGCTGTCCTTGATGTCAGCTATAAAT
CTGACTC
  Box motif
  Complementary to target RNA
length 66
organism Mus_musculus
snoRNA name SNORD52
alias
chromosome ⁄ contig 17
locus ⁄ host gene Poly:10:SNORD52
organization Poly
target RNA 28S rRNA
modification type C/D
modification site 28S:U3581
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved