snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD99
sequence
ACTGGTCCATGATGAAACCCATTATCAGTGGACATCTATGGATGAGAAATGCGGATATG
GGACTGAGACCAGTTCTTAGG
  Box motif
  Complementary to target RNA
length 80
organism Mus_musculus
snoRNA name SNORD99
alias
chromosome ⁄ contig 4
locus ⁄ host gene Poly:15:SNORA16
organization Poly
target RNA 28S rRNA
modification type C/D
modification site 28S:A2540
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved