snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA61
sequence
ACCCTCCGGTTTCCCTTTCCCATCGGATCTTGACGCTGGTCTTGGTGGTCGTTAAGGAG
GAAGAGCACCCTGAAGCTGGCCTCACAGCGATGCAGTCTGCTGTAGAGCAGCAGGCCAGA
CTCAGACATGC
  Box motif
  Complementary to target RNA
length 130
organism Mus_musculus
snoRNA name SNORA61
alias ACA61
chromosome ⁄ contig 4
locus ⁄ host gene Poly:15:SNORA16
organization Poly
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U2263
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved