snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA44
sequence
GGGGGTGTTTCCAGGGGCGGTGGCTGCTTGTAGCCATGGGATCTCCAACTGCATGCCAG
AGTAATGGGGAGGCTTTGACAGCCCAGGTCATCACAGTGCCTGCAGCTGCCACTCAGCTT
CTGTATAG
  Box motif
  Complementary to target RNA
length 127
organism Mus_musculus
snoRNA name SNORA44
alias ACA44
chromosome ⁄ contig 2
locus ⁄ host gene Mono:508:SNORA44
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U687,18S:U823
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved