snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA51
sequence
GGAGTCCTGCTTACCACACACTGTATTCTTATGCTGACGGTATATGGAGAGGAGGCAGA
GCAAACCGACTCCCTGTACAGCTTATCCCAGGTCATTGTGCCTGATCTGTATTGTGAATG
GGGAGACATGG
  Box motif
  Complementary to target RNA
length 130
organism Mus_musculus
snoRNA name SNORA51
alias ACA51
chromosome ⁄ contig 8
locus ⁄ host gene Mono:160:SNORA51
organization Mono
target RNA Unknown
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved