snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA9
sequence
TAGCAAGCCTCCAGCGTGCTTGGGTCTGCAGTGACCCTGTGCATTCCTACAGTGCTTGC
CAGAACAATTTTGAAGTGGTTTGAGGCCTTGCCCTGCCCTCTCCAGAGCAAGGTTATAGA
AATTTCAGACAATA
  Box motif
  Complementary to target RNA
length 133
organism Mus_musculus
snoRNA name SNORA9
alias ACA9
chromosome ⁄ contig 11
locus ⁄ host gene Mono:420:SNORA9
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U1496,28S:U1584
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved