snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA74
sequence
TCCAGCAGTTGTCAGCTATCCAGGCTGTGTGGTGCCCGAGATCGTGTTACACTGTTGGA
AGAGTAAACACTGCCTTACTAAGGGTCGGCTCCCAGCACTGTTTTGGTGTCTGGTGCTGA
GTACTTTCAGGCAGTATTGCATCCCTGAGAGTGGAATGACTCCTTGTGGAGTTGGTCCTG
GTCTGGGTGCAAACAAT
  Box motif
  Complementary to target RNA
length 196
organism Mus_musculus
snoRNA name SNORA74
alias U19
chromosome ⁄ contig 18
locus ⁄ host gene Mono:7:SNORA74
organization Mono
target RNA 28S rRNA, U3 snoRNA
modification type H/ACA
modification site 28S:U3418,28S:U3420,U3:U8
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved