snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA61
sequence
ACCCTCTAGTTTCCTTTCCCGTCGGGTCTCAACACTGGTCTCGGTGGTCGTAAAGGAGG
AAGAACACACTGAAGCTGGCCTAACAGTGATGCAGTCTGCTGTAGAGCATCAGGCCAGAT
CCAAACATCT
  Box motif
  Complementary to target RNA
length 129
organism Mus_musculus
snoRNA name SNORA61
alias ACA61
chromosome ⁄ contig 9
locus ⁄ host gene Mono:315:SNORA61
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U2263
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved