snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA3
sequence
GCCAAGGCTAGAGTCACATCCTGACATGGTACTTGTCCTGGTGTGCTAGAGTTCTCGAG
GAGAATCTGCTGGTCTTGATTTATTGGTAGGGGCCTTCAGTGTCCCTTCTAGTGCCCAGA
TCAGAAACATGG
  Box motif
  Complementary to target RNA
length 131
organism Mus_musculus
snoRNA name SNORA3
alias ACA3
chromosome ⁄ contig 12
locus ⁄ host gene Mono:405:SNORA3
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3576,28S:U3615
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved