snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA33
sequence
AAGTCAGCCAATTAATCTGCTTATCTCAATGTTTCTGCAGAAATTTAGAAAGGGCTGGA
AATGATAGTGTCATGATATGAATCTTAAGGGCAGCTGAAGCCTTTAAGGTCCCTGAAAGT
GGCTACAGTA
  Box motif
  Complementary to target RNA
length 129
organism Mus_musculus
snoRNA name SNORA33
alias ACA33
chromosome ⁄ contig 12
locus ⁄ host gene Mono:400:SNORA33
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4648
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved