snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA21
sequence
CCCCTTTTAAAAGCACTCAGTGAGCCTTTTGCTAGTGACCCACTGAGCCGTTAAGAAGG
GGCAGAGTCAAAAACACCACTTTTGGGTGAAGTGGCAACGTGTTGTGTTATTTAACTTCA
ATCGGTGTTGTGACAAGA
  Box motif
  Complementary to target RNA
length 137
organism Mus_musculus
snoRNA name SNORA21
alias ACA21
chromosome ⁄ contig 7
locus ⁄ host gene Mono:53:SNORA21
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4083,28SU4152
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved