snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA57
sequence
CCTCCTTTTCTTGGCGGGGACCGGGCGTGCGGTCCCGCTCCCCGTAATGTACGGAGGTA
GAAGAAAGGGCTCTGGCCCTCTCGGCGTTATGTCTTCGGTGCTTGCGGCTTCCCGTTCGC
GGGTTCTATCCTCAGACGCCGGAACACTT
  Box motif
  Complementary to target RNA
length 148
organism Mus_musculus
snoRNA name SNORA57
alias U99
chromosome ⁄ contig 19
locus ⁄ host gene Mono:125:SNORA57
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1005
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved