snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA31
sequence
TTGCATGCATTGACAGCCCTTGACCAGTTTGTGGTTGTTCTTCTGGTCTGTACTAGGAT
GCAAAAGAAAAGCTCCCTGAGTGTTCTGCCTGCCTCTGTGGCGTTTAGATTGAATTGGGA
TATACATCT
  Box motif
  Complementary to target RNA
length 128
organism Mus_musculus
snoRNA name SNORA31
alias ACA31
chromosome ⁄ contig 2
locus ⁄ host gene Mono:493:SNORA31
organization Mono
target RNA 18S rRNA, 28S rRNA
modification type H/ACA
modification site 18S:U220,28S:U3390
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved