snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA68
sequence
CTGGCACCCATCCCAAGAACTGGTGCTGCCTGTAGTTGCTGTCTTAACAGTGGTGCACA
CAGCAAAGGGGCTTTGTTGCTTTTGGGGGGGGGGCTGTGTAGTGCCCCCCCAGAGTGAAT
CAGTAGGTTCTACAGTC
  Box motif
  Complementary to target RNA
length 136
organism Mus_musculus
snoRNA name SNORA68
alias U68
chromosome ⁄ contig 1
locus ⁄ host gene Mono:113:SNORA68
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4075
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved