snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD12
sequence
GTACACATGTGTGATGACACAACTTTTTTCCCCATCAGATCAACCATGTTGATCACATT
CTTTTAAGCCAGTATCTTGTTTAT
  Box motif
  Complementary to target RNA
length 83
organism Mus_musculus
snoRNA name SNORD12
alias
chromosome ⁄ contig X
locus ⁄ host gene Mono:204:SNORD12
organization Mono
target RNA 28S rRNA
modification type C/D
modification site 28S:G3554
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved