snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA4
sequence
TGACCAGTTTCTGTCCATCCTGCTCATAAGAAGTGCTCCAGAATATTAAAAAGCCTTAA
CCAATTCATGCTATTTGGCAGAATGAGTAAGACCACACTCCACTGTGGGCTATACTACTT
AGTATGGTTCATTACTATATTGTGGCCTACATT
  Box motif
  Complementary to target RNA
length 152
organism Mus_musculus
snoRNA name SNORA4
alias
chromosome ⁄ contig 9
locus ⁄ host gene Mono:333:SNORA4
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1347
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved