snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA65
sequence
CTGAATACTGTAACGGTCCCCTTTAAAAGAACGAGGACTCAGTGCTGAGCTGACAGGAA
GCCCCAGGGTTGTCCTACATGTGGGTGACTCTGTGCTGAAAGCATGGGAACAGCC
  Box motif
  Complementary to target RNA
length 114
organism Mus_musculus
snoRNA name SNORA65
alias U65
chromosome ⁄ contig 8
locus ⁄ host gene Mono:145:SNORA65
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4055,28S:U4109
accession no
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved