snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA38
sequence
ACCAAGTTGAAAAACATCTTTGGTTCCCTGTCCTTGGAGACATAAGAATTGGAGGCAAA
GAAATGTGGTAGATTTGGAAAGATTTGGGGACCAGCTTGCTCCCCACAGGCTTGGGATCA
GGCATCCCTCAGAG
  Box motif
  Complementary to target RNA
length 133
organism Mus_musculus
snoRNA name SNORA38
alias ACA38
chromosome ⁄ contig 3
locus ⁄ host gene Mono:346:SNORA38
organization Mono
target RNA Unknown
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved