snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA32
sequence
TGGTCATCACCAAGGATTTTAGAATGCAGTTTCTCATTTGCGTGGACGTGACCATAAAG
AAAAATTCCCATGAGGTTTTTCATATGCTACTACCGGTTGGGAACATGA
  Box motif
  Complementary to target RNA
length 108
organism Mus_musculus
snoRNA name SNORA32
alias ACA32
chromosome ⁄ contig 16
locus ⁄ host gene Mono:293:SNORA32
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U1662
accession no
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved