snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD58
sequence
CTGCGATGATGTCATTCATATCTTAGGACACCTTTGGATTAATCATGAAAATAACTATC
CTCTGAGCAGC
  Box motif
  Complementary to target RNA
length 70
organism Mus_musculus
snoRNA name SNORD58
alias
chromosome ⁄ contig 14
locus ⁄ host gene Mono:173:SNORD58
organization Mono
target RNA 28S rRNA
modification type C/D
modification site 28S:U3879, 28S:G3880
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved