snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA76
sequence
GTGCTGCCTTTGAGCCCCCTGTAGTGCCGGGGATTAAGCTGCGGCGCCATAGCACTTTG
CAGGCGCATAACTGGGGCCGCCTGTCTTTCCCAGGCGGCCCTTTTAACCTAGCTACAGGC
  Box motif
  Complementary to target RNA
length 119
organism Mus_musculus
snoRNA name SNORA76
alias ACA62
chromosome ⁄ contig X
locus ⁄ host gene Mono:217:SNORA76
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U34,18S:U105
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved