snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA71
sequence
CCCTGTATTCAAAAGTGATTGTAGGCTGCCTGTGTCCTGGACATTGATACTGCAGGGGA
AGATACTGAAAGCCTTTCCCGGCGTGTGGAAGGTCTGATTCTATCCTTGTCAATCCCTGG
CGCTTTGGAATA
  Box motif
  Complementary to target RNA
length 131
organism Mus_musculus
snoRNA name SNORA71
alias U71d
chromosome ⁄ contig 14
locus ⁄ host gene Mono:168:SNORA71
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U407
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved