snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD113
sequence
AGGACCAATGATGAGATCTGGTGGCGTTTGAGTGATACTCCATGAACGCCAAGTATCCA
GAAATCTGAGGTCAAT
  Box motif
  Complementary to target RNA
length 75
organism Mus_musculus
snoRNA name SNORD113
alias
chromosome ⁄ contig 12
locus ⁄ host gene Poly:12:SNORD113
organization Poly
target RNA Unknown
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved