snOPY snoRNA Orthological Gene Database
Mus_musculus SNORD93
sequence
TGGCCAAGGATGAGAACTCTAACCTGACTGGATACGCTGCTGTGATGGGTTAAAGGATT
TACCTGAGGCCA
  Box motif
  Complementary to target RNA
length 71
organism Mus_musculus
snoRNA name SNORD93
alias
chromosome ⁄ contig 5
locus ⁄ host gene Mono:71:SNORD93
organization Mono
target RNA 18S rRNA
modification type C/D
modification site 18S:A577
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved