snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA41
sequence
TTCCTCAGCTACTGGTCTGCAGCTGTCCTCATGGTAGCAGTTGTAGCATTCCTCTATGG
GAAAGAAAATGTTACACCATTTAATGCCTCTTTCTTGGCCACACAAAAGAAGAATATGCT
TGACAGACACAA
  Box motif
  Complementary to target RNA
length 131
organism Mus_musculus
snoRNA name SNORA41
alias ACA41
chromosome ⁄ contig 7
locus ⁄ host gene Mono:57:SNORA41
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1643
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved